View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_high_36 (Length: 259)
Name: NF8199_high_36
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 28 - 239
Target Start/End: Complemental strand, 34563729 - 34563518
Alignment:
| Q |
28 |
agaatgaccaaagaaacgagaattttgggttgcattttgttagtgttggttctaagtggtggaggtgagacacgacatttgaacccaacaatggtaagtg |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34563729 |
agaatgaccaaagaaacgagaattttgagttgcattttgttagtgttggttctatgtggtagaggtgagacacgacatctgaacccaacaatggtaagtg |
34563630 |
T |
|
| Q |
128 |
atcatcacatgttagcaacttctcattggaattggaattccatacaaccatttgcaaaagaagaaggtggaaaacgtgacgagcttcaaagattaagtcc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34563629 |
atcatcacatgttagcaacttctcattggaattggaattccatacaaccatttccagaagaagaaggtggaaaacgtgacgagctacaaagattaagtcc |
34563530 |
T |
|
| Q |
228 |
cggtggacctga |
239 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34563529 |
cggtggacctga |
34563518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University