View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8199_high_40 (Length: 252)

Name: NF8199_high_40
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8199_high_40
NF8199_high_40
[»] chr8 (1 HSPs)
chr8 (1-238)||(30667897-30668134)


Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 30668134 - 30667897
Alignment:
1 ttttgtaacgatgacaataacacattaacacgttatttgatcatttgaaatcagttagtttggatcccccaaaatttgccgatgccaggccaagagagca 100  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||    
30668134 ttttgtaacgatgacaataacacattaacacgtcatttgatcatttgaaatcagttagtttggatcccccaaaattagccgatgccaagccaagagagca 30668035  T
101 ttgttcaactgtgacaactcttgagctggcttcccatcatctttgggtagcagtaaaatgacctgatattcggccttaaatctgccacatcaatacagtg 200  Q
    |||||||||  ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
30668034 ttgttcaaccatgacaactcttaagctggcttcccatcgtctttgggtagcagtaaaatgacctgatattcagccttaaatctgccacatcaatacagtg 30667935  T
201 ctaaaagcgtcacaactcactaatggatggcatggata 238  Q
    ||||||||||||||||||||||||||||||||||||||    
30667934 ctaaaagcgtcacaactcactaatggatggcatggata 30667897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University