View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_high_40 (Length: 252)
Name: NF8199_high_40
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 30668134 - 30667897
Alignment:
| Q |
1 |
ttttgtaacgatgacaataacacattaacacgttatttgatcatttgaaatcagttagtttggatcccccaaaatttgccgatgccaggccaagagagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
30668134 |
ttttgtaacgatgacaataacacattaacacgtcatttgatcatttgaaatcagttagtttggatcccccaaaattagccgatgccaagccaagagagca |
30668035 |
T |
 |
| Q |
101 |
ttgttcaactgtgacaactcttgagctggcttcccatcatctttgggtagcagtaaaatgacctgatattcggccttaaatctgccacatcaatacagtg |
200 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30668034 |
ttgttcaaccatgacaactcttaagctggcttcccatcgtctttgggtagcagtaaaatgacctgatattcagccttaaatctgccacatcaatacagtg |
30667935 |
T |
 |
| Q |
201 |
ctaaaagcgtcacaactcactaatggatggcatggata |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30667934 |
ctaaaagcgtcacaactcactaatggatggcatggata |
30667897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University