View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_high_41 (Length: 251)
Name: NF8199_high_41
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_high_41 |
 |  |
|
| [»] scaffold0316 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 45485074 - 45484930
Alignment:
| Q |
1 |
aagcataaaatatgttattttcattttaaaatttcnnnnnnn-aggttccttaactagtgccccggagcaccggttaacatgacccaagaaa-caaaagg |
98 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||||| ||| ||||||| |
|
|
| T |
45485074 |
aagcataaaatgtgttatttttattttaaaatttcttttttttaggttccttaaccagtgccccgaagcaccggttaacatgacccaaaaaaacaaaagg |
45484975 |
T |
 |
| Q |
99 |
ttagttttgtctcatgggtattggtatccacattttgtcattatt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45484974 |
ttagttttgtctcatgggtattggtatccacattttgtcattatt |
45484930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 190 - 247
Target Start/End: Complemental strand, 45484180 - 45484123
Alignment:
| Q |
190 |
ctattctaaaaacttgtaaatatacatacattatacaaaaatgagtttcttctcactc |
247 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45484180 |
ctatgctaaaaaccagtaaatatacatacattatacaaaaatgagtttcttttcactc |
45484123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 164 - 202
Target Start/End: Complemental strand, 45484919 - 45484881
Alignment:
| Q |
164 |
tgagcttttaactaagcctggtttttctattctaaaaac |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45484919 |
tgagcttttaactaagcttggtttttctattctaaaaac |
45484881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 86
Target Start/End: Original strand, 43159909 - 43159983
Alignment:
| Q |
13 |
tgttattttcattttaaaatttcnnnnnnnaggttccttaactagtgccccggag-caccggttaacatgaccca |
86 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
43159909 |
tgttattttcattttaaaatttctttttttaggttctttaaccaatgccccggagacaccggttaacatgaccca |
43159983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 25474687 - 25474654
Alignment:
| Q |
1 |
aagcataaaatatgttattttcattttaaaattt |
34 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
25474687 |
aagcataaaaaatgttattttcattttaaaattt |
25474654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 85
Target Start/End: Complemental strand, 11893437 - 11893401
Alignment:
| Q |
49 |
cttaactagtgccccggagcaccggttaacatgaccc |
85 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
11893437 |
cttaaccagtgccccggagcaccggttagcatgaccc |
11893401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 80
Target Start/End: Original strand, 25377182 - 25377217
Alignment:
| Q |
44 |
ggttccttaactagtgccccggagcaccggttaacat |
80 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25377182 |
ggttccttaactagtgccccgga-caccggttaacat |
25377217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 80
Target Start/End: Complemental strand, 47305529 - 47305497
Alignment:
| Q |
48 |
ccttaactagtgccccggagcaccggttaacat |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47305529 |
ccttaactagtgccccggagcaccggttaacat |
47305497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 86
Target Start/End: Original strand, 40234663 - 40234704
Alignment:
| Q |
46 |
ttccttaactagtgccccgg-agcaccggttaacatgaccca |
86 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
40234663 |
ttccttaaccagtgccccgggagcaccggttaacatgaccca |
40234704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0316 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0316
Description:
Target: scaffold0316; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 1327 - 1414
Alignment:
| Q |
1 |
aagcataaaatatgttattttcattttaaaa-tttcnnnnnnnaggttccttaactagtgcccc-ggagcaccggttaacatgaccca |
86 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| |||||||||| | ||||||| || |||||||||||||||||||| |
|
|
| T |
1327 |
aagcataaaaaatgttattttcattttaaaaatttctttttttaggttccttagcccgtgccccaggggcaccggttaacatgaccca |
1414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 85
Target Start/End: Original strand, 885745 - 885824
Alignment:
| Q |
7 |
aaaatatgttattttcattttaaaatttcnnnnnnnaggttccttaactagtgccccg-gagcaccggttaacatgaccc |
85 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||| | ||||||| | |||||||||||||||||| |
|
|
| T |
885745 |
aaaaaatgttattttcattttaaaatttccttttttaggttccttaaccactgccccgaggacaccggttaacatgaccc |
885824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 7299921 - 7299887
Alignment:
| Q |
1 |
aagcataaaatatgttattttcattttaaaatttc |
35 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7299921 |
aagcataaaatatgttattttcaatttaaaatttc |
7299887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 87
Target Start/End: Original strand, 35044038 - 35044076
Alignment:
| Q |
49 |
cttaactagtgccccggagcaccggttaacatgacccaa |
87 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35044038 |
cttaaccagtgccccggggcaccggttaacatgacccaa |
35044076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 86
Target Start/End: Original strand, 7246640 - 7246680
Alignment:
| Q |
46 |
ttccttaactagtgccccggagcaccggttaacatgaccca |
86 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7246640 |
ttccttaaccagtgccccggagcactagttaacatgaccca |
7246680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 31064520 - 31064479
Alignment:
| Q |
49 |
cttaactagtgccccgg-agcaccggttaacatgacccaaga |
89 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
31064520 |
cttaactagtgccccgggagcaccggttaacatgaccaaaga |
31064479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 80
Target Start/End: Original strand, 34759032 - 34759064
Alignment:
| Q |
48 |
ccttaactagtgccccggagcaccggttaacat |
80 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
34759032 |
ccttaactagtgccccggtgcaccggttaacat |
34759064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 43077235 - 43077202
Alignment:
| Q |
1 |
aagcataaaatatgttattttcattttaaaattt |
34 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
43077235 |
aagcataaaatatgttattttcaatttaaaattt |
43077202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 85
Target Start/End: Original strand, 11009749 - 11009789
Alignment:
| Q |
46 |
ttccttaactagtgccccgg-agcaccggttaacatgaccc |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
11009749 |
ttccttaactagtgtcccgggagcaccggttaacatgaccc |
11009789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 35501506 - 35501542
Alignment:
| Q |
47 |
tccttaactagtgccccggagcaccggttaacatgac |
83 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
35501506 |
tccttaaccagtgctccggagcaccggttaacatgac |
35501542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University