View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8199_high_46 (Length: 230)

Name: NF8199_high_46
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8199_high_46
NF8199_high_46
[»] chr2 (2 HSPs)
chr2 (1-92)||(28535980-28536067)
chr2 (161-212)||(28535860-28535911)


Alignment Details
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 28536067 - 28535980
Alignment:
1 tgatattgtgaatttcaaattcttgtttattaattcaaaattaattnnnnnnnnnnnnctagcatgtgagaaaatatataagaccttgatgg 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||||||||||||||    
28536067 tgatattgtgaatttcaaattcttgtttattaattcaaaattaatt----aaaaaaaactagcatgtgagaaaatatataagaccttgatgg 28535980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 161 - 212
Target Start/End: Complemental strand, 28535911 - 28535860
Alignment:
161 gagtaccttcctacctttatgtttggctcttcaactgctgctagttgattac 212  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||    
28535911 gagtaccttcctacctttatgtttggttcttcaactgctgctagttgattac 28535860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University