View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_high_46 (Length: 230)
Name: NF8199_high_46
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_high_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 28536067 - 28535980
Alignment:
| Q |
1 |
tgatattgtgaatttcaaattcttgtttattaattcaaaattaattnnnnnnnnnnnnctagcatgtgagaaaatatataagaccttgatgg |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28536067 |
tgatattgtgaatttcaaattcttgtttattaattcaaaattaatt----aaaaaaaactagcatgtgagaaaatatataagaccttgatgg |
28535980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 161 - 212
Target Start/End: Complemental strand, 28535911 - 28535860
Alignment:
| Q |
161 |
gagtaccttcctacctttatgtttggctcttcaactgctgctagttgattac |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28535911 |
gagtaccttcctacctttatgtttggttcttcaactgctgctagttgattac |
28535860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University