View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_high_50 (Length: 213)
Name: NF8199_high_50
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_high_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 23467352 - 23467547
Alignment:
| Q |
1 |
cagatgaggaagaaagcctttgacagctttaacaagatacgagcaatgattatgatgataatcagtgttatcactgatatagcagcgagtatattcactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
23467352 |
cagatgaggaagaaagcctttgacagctttaacaaaatacgtgcaatgattatgatgataatcagtgttaccactgatatagcagcgattatattcactc |
23467451 |
T |
|
| Q |
101 |
tcttatcttccatatcagaacttcacattttatgttgtatgataaagatggaatggaagataaaagataaattattagatttctcacctttgtaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
23467452 |
tcttatcttccatatcagaacttcacattttatgttttatgataaagatggaatggaagataaaagttgaattattagatttctcacctttgtaat |
23467547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University