View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_19 (Length: 416)
Name: NF8199_low_19
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 15 - 250
Target Start/End: Original strand, 34952925 - 34953160
Alignment:
| Q |
15 |
atgaacattgaataacagataaaggatcaaaacggttttttagcctaatttatttattcacaattaagattactttattttctcctttaaagtgaattgt |
114 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34952925 |
atgaacattgaataaaagataaaggatcaaaagaattttttagcctaatttatttattcacaattaagattactttattttttcctttaaagtgaattgt |
34953024 |
T |
 |
| Q |
115 |
ttcttttataagaagtaatcctaaannnnnnnggaccataatgtagccgatgtcaaagataacaaagtgttttatatagtttatggtcgaaaattagttg |
214 |
Q |
| |
|
||||||||||||||| ||||||||| ||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
34953025 |
ttcttttataagaagcaatcctaaatttttttggatcataatgtagccgatgtctaagataacaaagtgctttatatagtttatggtcgaaaattacttg |
34953124 |
T |
 |
| Q |
215 |
aaattctatcatcaacgggcatcacttctcataagt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34953125 |
aaattctatcatcaacgggcatcacttctcataagt |
34953160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University