View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_20 (Length: 408)
Name: NF8199_low_20
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 4853741 - 4853661
Alignment:
| Q |
1 |
tttatcttaaaacttgttttctttatattaaagacataattttataataagtagaaattactactttcaataaaaacatca |
81 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4853741 |
tttatcttagaacttgtttactttatattaaaaacataattttataataaatagaaattactactttcaataaaaacatca |
4853661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 4853615 - 4853561
Alignment:
| Q |
27 |
attaaagacataattttataataagtagaaattactactttcaataaaaacatca |
81 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
4853615 |
attaaaaacataattttataataaatagaaataactactttcaataaaaacatca |
4853561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University