View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8199_low_20 (Length: 408)

Name: NF8199_low_20
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8199_low_20
NF8199_low_20
[»] chr8 (2 HSPs)
chr8 (1-81)||(4853661-4853741)
chr8 (27-81)||(4853561-4853615)


Alignment Details
Target: chr8 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 4853741 - 4853661
Alignment:
1 tttatcttaaaacttgttttctttatattaaagacataattttataataagtagaaattactactttcaataaaaacatca 81  Q
    ||||||||| ||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||    
4853741 tttatcttagaacttgtttactttatattaaaaacataattttataataaatagaaattactactttcaataaaaacatca 4853661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 4853615 - 4853561
Alignment:
27 attaaagacataattttataataagtagaaattactactttcaataaaaacatca 81  Q
    |||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||    
4853615 attaaaaacataattttataataaatagaaataactactttcaataaaaacatca 4853561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University