View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_26 (Length: 357)
Name: NF8199_low_26
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 44 - 276
Target Start/End: Original strand, 26277372 - 26277608
Alignment:
| Q |
44 |
gaatgaatgaatcaagaaatcaagtgggacattttt---gactaaaa-tataatgggacattattgtcatcccacaaatttagaaatcccaacaaattgg |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26277372 |
gaatgaatgaatcaagaaatcaagtgggacattttttttgactaaaaatataatgggacattattgtcatcccacaaatttagaaatcccaccaaattgg |
26277471 |
T |
|
| Q |
140 |
tcgcagtccacacaaatatctataaatacagtcttcaactgaacacaaccgcttgcaatagcctatcaaaattgtgatcatgtgaagaagacaaactctt |
239 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277472 |
tcgcagtccacacaaaaatatataaatacagtcttcaactgaacacatccgcttgcaatagcctatcaaaattgtgatcatgtgaagaagacaaactctt |
26277571 |
T |
|
| Q |
240 |
gcatctatctatatacggtaaggatagaatatgggtg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277572 |
gcatctatctatatacggtaaggatagaatatgggtg |
26277608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 186 - 251
Target Start/End: Original strand, 26269872 - 26269937
Alignment:
| Q |
186 |
aaccgcttgcaatagcctatcaaaattgtgatcatgtgaagaagacaaactcttgcatctatctat |
251 |
Q |
| |
|
||||||||| || ||||||||||||||||||||| |||||||||||||||||||| |||| ||||| |
|
|
| T |
26269872 |
aaccgcttgtaacagcctatcaaaattgtgatcacgtgaagaagacaaactcttgaatctgtctat |
26269937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University