View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_27 (Length: 354)
Name: NF8199_low_27
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 3 - 338
Target Start/End: Complemental strand, 31497472 - 31497142
Alignment:
| Q |
3 |
gaggttcgggtttttgtgtaacgttgtgtccacgtttgtctgctattcaattcaattcaacactcgatagaaataaatggacggtgccttgaactcacgc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31497472 |
gaggttcgggtttttgtgtaacgttgtgtccacgtttgtctgctattcaattcaa-----cactcgatagaaataaatggacggtgccttgaactcacgc |
31497378 |
T |
|
| Q |
103 |
gctttcaagggcatgtgagccccactagggttgattatgtaattaccttttccattgcatgaaaacagcaaaattcactagtgtagttggattagaactg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31497377 |
gctttcaagggcatgtgagccccactagggttgattatgtaattaccttttctattgcatgaaaacagcaaaattcactagtgtagttggattagaactg |
31497278 |
T |
|
| Q |
203 |
aatggaacaatgcttgcaaaaggaaattaatcatgcaaaactttttcctttctttctggttattattattacatgccaaatttacttgtttggtttgcat |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31497277 |
aatggaacaatgcttgcaaaaggaaattaatcatgcaaaactttttcctttctttctggttattattattacatgccaaatttacttgtttggtttgcat |
31497178 |
T |
|
| Q |
303 |
caagaaaaaagtttgataatgcatgcatgatgggag |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31497177 |
caagaaaaaagtttgataatgcatgcatgatgggag |
31497142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University