View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8199_low_28 (Length: 345)

Name: NF8199_low_28
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8199_low_28
NF8199_low_28
[»] chr7 (4 HSPs)
chr7 (214-328)||(19414879-19414991)
chr7 (1-53)||(19415197-19415249)
chr7 (4-53)||(19469697-19469746)
chr7 (187-217)||(19415039-19415069)


Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 214 - 328
Target Start/End: Complemental strand, 19414991 - 19414879
Alignment:
214 taatcttcccattatcagttttcccgaatggatgaaatttatgttacaacttggtgttctgtaccttaatctctttataggcatcttgatgtgcctaaat 313  Q
    |||||||| |||||||||||||||||||||||| ||||||||||||||  || |||||||||||||||||||||||||||||||||||||||||||||||    
19414991 taatcttctcattatcagttttcccgaatggatcaaatttatgttaca--tttgtgttctgtaccttaatctctttataggcatcttgatgtgcctaaat 19414894  T
314 tgcctaataccattt 328  Q
    |||||||||||||||    
19414893 tgcctaataccattt 19414879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 19415249 - 19415197
Alignment:
1 aatgttttatgactctaaattatacgagcaggcaaaaacaactcgctcatatg 53  Q
    ||||||||||||||||||||||| ||||||||||||||||||| |||||||||    
19415249 aatgttttatgactctaaattatgcgagcaggcaaaaacaactagctcatatg 19415197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 4 - 53
Target Start/End: Complemental strand, 19469746 - 19469697
Alignment:
4 gttttatgactctaaattatacgagcaggcaaaaacaactcgctcatatg 53  Q
    |||||||||||||||||| | ||||||| |||||||| ||||||||||||    
19469746 gttttatgactctaaattgtgcgagcagacaaaaacagctcgctcatatg 19469697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 217
Target Start/End: Complemental strand, 19415069 - 19415039
Alignment:
187 gcatgctgatattaatgacatgccaattaat 217  Q
    |||||||||||||||||||||||||||||||    
19415069 gcatgctgatattaatgacatgccaattaat 19415039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University