View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_28 (Length: 345)
Name: NF8199_low_28
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 214 - 328
Target Start/End: Complemental strand, 19414991 - 19414879
Alignment:
| Q |
214 |
taatcttcccattatcagttttcccgaatggatgaaatttatgttacaacttggtgttctgtaccttaatctctttataggcatcttgatgtgcctaaat |
313 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19414991 |
taatcttctcattatcagttttcccgaatggatcaaatttatgttaca--tttgtgttctgtaccttaatctctttataggcatcttgatgtgcctaaat |
19414894 |
T |
|
| Q |
314 |
tgcctaataccattt |
328 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19414893 |
tgcctaataccattt |
19414879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 19415249 - 19415197
Alignment:
| Q |
1 |
aatgttttatgactctaaattatacgagcaggcaaaaacaactcgctcatatg |
53 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
19415249 |
aatgttttatgactctaaattatgcgagcaggcaaaaacaactagctcatatg |
19415197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 4 - 53
Target Start/End: Complemental strand, 19469746 - 19469697
Alignment:
| Q |
4 |
gttttatgactctaaattatacgagcaggcaaaaacaactcgctcatatg |
53 |
Q |
| |
|
|||||||||||||||||| | ||||||| |||||||| |||||||||||| |
|
|
| T |
19469746 |
gttttatgactctaaattgtgcgagcagacaaaaacagctcgctcatatg |
19469697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 217
Target Start/End: Complemental strand, 19415069 - 19415039
Alignment:
| Q |
187 |
gcatgctgatattaatgacatgccaattaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19415069 |
gcatgctgatattaatgacatgccaattaat |
19415039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University