View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_33 (Length: 321)
Name: NF8199_low_33
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 45 - 306
Target Start/End: Complemental strand, 52557868 - 52557607
Alignment:
| Q |
45 |
attgtaaaaatgatgatttcatattttaatttgaaaagttcccgtaaatacaaatcataagaaaattgtgaacaata-cccccctcttctcaagcacatt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
52557868 |
attgtaaaaatgatgatttcatattttaatttgaaaagttcctgtaaatacaaatcataagaaaattgtgaacaataacccccctcttctca-gcacatt |
52557770 |
T |
|
| Q |
144 |
atgtgtgtgtgaattatgcaactatattcttttaaacaaaaacaagtttagagcctattccatgttcatcatgggctaatttagagagtcctcgtnnnnn |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52557769 |
atgtgtgtgtgaattatgcaactatattcttttaaacaaaaacaagtttagagcctattccatgttcatcatgggctaatttagagagtcctcgtaaaaa |
52557670 |
T |
|
| Q |
244 |
nnntagtttagatcctagattatcattaaatattgctttaaagttgtaaattattagtattat |
306 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52557669 |
aaatagtttatatcctagattatcattaaatattgctttaaagttgtaaattattagtattat |
52557607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University