View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_48 (Length: 262)
Name: NF8199_low_48
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 31128034 - 31127799
Alignment:
| Q |
18 |
ataattttattcttaatttagacgagaaatgtaaactacaaaattacctacacaaccttagtttatgcataaaataagatttcattcatttgtgctgcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31128034 |
ataattttattcttaatttagacgagaaatgtaaactacaaaattacctacacaaccttagtttatgcataaaataagatttcattcatttgtgctgcca |
31127935 |
T |
|
| Q |
118 |
cgcttctcaatctttaccgggaagccacctttcattatcgaagtaaggtgtgcagcgaactctggctcaacccctttatccattgcaggaaccaccctaa |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31127934 |
cgcttctcaatctttaccaggaagccacctttcattatcgaagtaaggtgtgcagcgaactccggctcaacccctttatccattgcaggaaccaccctaa |
31127835 |
T |
|
| Q |
218 |
actgcctcatgatcccagcaaccacccttttcatct |
253 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31127834 |
actgcctcatgatcccggcaaccacccttttcatct |
31127799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 118 - 253
Target Start/End: Complemental strand, 31078616 - 31078481
Alignment:
| Q |
118 |
cgcttctcaatctttaccgggaagccacctttcattatcgaagtaaggtgtgcagcgaactctggctcaacccctttatccattgcaggaaccaccctaa |
217 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| | || |||||||||||| | |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31078616 |
cgcttctcaattcttaccgagaagccacctttcatcaatgaggtaaggtgtgcaatgtactccggctcaacccctttatccattgcaggaaccaccctaa |
31078517 |
T |
|
| Q |
218 |
actgcctcatgatcccagcaaccacccttttcatct |
253 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
31078516 |
actgcctcatgatccctgcaaccaccctcttcatct |
31078481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 118 - 241
Target Start/End: Complemental strand, 31132645 - 31132522
Alignment:
| Q |
118 |
cgcttctcaatctttaccgggaagccacctttcattatcgaagtaaggtgtgcagcgaactctggctcaacccctttatccattgcaggaaccaccctaa |
217 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| || |||||||| |||| | | ||| |||| |||||||||| |||||| || |||| || ||||| |
|
|
| T |
31132645 |
cgcttcttgatctttaccggaaagccacctttcataattgaagtaagatgtgaatcaaacactggttcaaccccttcatccatcgctggaagcaacctaa |
31132546 |
T |
|
| Q |
218 |
actgcctcatgatcccagcaacca |
241 |
Q |
| |
|
||| ||| || || ||| |||||| |
|
|
| T |
31132545 |
actcccttataatgccaacaacca |
31132522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University