View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_49 (Length: 262)
Name: NF8199_low_49
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 3815683 - 3815445
Alignment:
| Q |
1 |
agtatgcaacttgctgtgttgtcacacttatagagcaaattttgtatttgggccaagcttgcaaaaacctactcatataggactatatttggtcatagct |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3815683 |
agtatgcaacttgttgtgttgtcacacttatagagcaaattttgtatttgggccaagcttgcaaaaacctactcatataggactatatttggtcatagct |
3815584 |
T |
 |
| Q |
101 |
atgagctaccaacaccattttttctgctattaacaatctcttcccattttcttttgctttaaataccattttcttcgtctgtaagacatagtttagttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
3815583 |
atgagctaccaacaccattttttctgctattaacaatctcttcctattttctttt-ctttaaataccattttcctcgtctgtaagacatagtttaaatga |
3815485 |
T |
 |
| Q |
201 |
caacatcgatattggtatattatacacattcactcatatt |
240 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3815484 |
caatatcgatattgttatattatacacattcactcatatt |
3815445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University