View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_52 (Length: 255)
Name: NF8199_low_52
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 8 - 241
Target Start/End: Original strand, 4445604 - 4445837
Alignment:
| Q |
8 |
acattattctttaatttatttatatgtggtaggatttgaagatattaatagtggctgttgtggaagtggatacattgaagcatcagttttgtgcaataag |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4445604 |
acattcttctttaatttatttatatgtggtaggatttgaagatattaatagtggctgttgtggaagtggatacattgaagcatcagttttgtgcaataag |
4445703 |
T |
 |
| Q |
108 |
gtttcaaatgtgtgccctgacccatctaagtatatgttttgggattcaattcatcctacagagaaggcataccacaacctcttcttggctttccaaccca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4445704 |
gtttcaaatgtgtgccctgacccatctaagtatatgttttgggattcaattcatcctacagagaaggcataccacaacctcttcttggctttccaaccca |
4445803 |
T |
 |
| Q |
208 |
ccattgatttcattgtcaacaactagaataatga |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4445804 |
ccattgatttcattgtcaacaactagaataatga |
4445837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 187
Target Start/End: Complemental strand, 34639217 - 34639062
Alignment:
| Q |
32 |
tgtggtaggatttgaagatattaatagtggctgttgtggaagtggatacattgaagcatcagttttgtgcaataaggtttcaaatgtgtgccctgaccca |
131 |
Q |
| |
|
||||||||| ||||| || || || ||||||||||||||||||| | |||||||||| || || |||| ||| ||||| |||| || |||| ||| |
|
|
| T |
34639217 |
tgtggtagggtttgatgaggttgatcgtggctgttgtggaagtggtttcattgaagcaacatttatgtgtaatcgtatttcacatgtatgttctgatcca |
34639118 |
T |
 |
| Q |
132 |
tctaagtatatgttttgggattcaattcatcctacagagaaggcataccacaacct |
187 |
Q |
| |
|
|| || ||| | |||||||||||||| ||||| || ||||||||||| || ||||| |
|
|
| T |
34639117 |
tcaaaatatgtcttttgggattcaatacatccgactgagaaggcatatcataacct |
34639062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University