View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_56 (Length: 250)
Name: NF8199_low_56
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 7723859 - 7724098
Alignment:
| Q |
1 |
cagaagatgcagtgtttctctccagcaatgactaacgagttccgtttcattgatgaaaccaatcatgattctgaaaatggcattccatttctctcttgga |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723859 |
cagaagatgcagtgtttctctccggcaattactaacgagttccgtttcattgatgaaaccaatcatgattctgaaaatggcattccatttctctcttgga |
7723958 |
T |
|
| Q |
101 |
gactctgatagaacaagcctcgttcatgaaaaatattaataataatgttaaaatagtaatagatttagtaaagcagctaggacggtcaagaccaatgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723959 |
gactctgatagaacaagcctcgttcatgaaaaatattaataataatgttataatagtaatagatttagtaaagcagctaggacggtcaagaccaatgata |
7724058 |
T |
|
| Q |
201 |
atgatatgtagaagatgtttttgattgcgatggttctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724059 |
atgatatgtagaagatgtttttgattgcgatggttctatg |
7724098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University