View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_64 (Length: 228)
Name: NF8199_low_64
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 210
Target Start/End: Original strand, 44322210 - 44322408
Alignment:
| Q |
12 |
gcagagataataagagctgcttcaagtattgaagcttagttattccttcaaaatggattcttgaatttagctaagtaatttttagagttctcttttgaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44322210 |
gcagagataataagagctgcttcaagtattgaagcttagttattccttcaaaatggattgttgaatttagctaagtaatctttagagttctcttttgaaa |
44322309 |
T |
|
| Q |
112 |
taaatcaataatatggattggtgttgtgagacagttgcgtcgaataaacacatacatctgtaaaagtataacttgtaggggtcatagtcatggtctacc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44322310 |
taaatcaataatatggattggtgttgtgagaccgttgcgtcgaataaacacatacatctgtaaaagtataacttgtaggggtcatagtcatggtctacc |
44322408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University