View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_low_71 (Length: 204)
Name: NF8199_low_71
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_low_71 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 8 - 184
Target Start/End: Complemental strand, 31348552 - 31348376
Alignment:
| Q |
8 |
tggagaagcagagaaaatggaggatgtccaatgagaaactgtgagtcattttcaaaataatggaatcattttagatttattgaaaaaacccaagaccaat |
107 |
Q |
| |
|
||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31348552 |
tggagaaacaaagaaaatggaggatgtcaaatgagaaactgtgagtcattttcaaaataatggaatcattttagatttattgaaaaaacccaagaccaat |
31348453 |
T |
 |
| Q |
108 |
tacatgatgtaaaaacacaatgaaatgatcaaaacacagtgttgcacgttagagaattaagttcggacgatgattct |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31348452 |
tacatgatgtaaaaacacaatgaaatgatcaaaacacagtgttgcacgttagagaattaagttcggacgatgattct |
31348376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 145
Target Start/End: Original strand, 13311002 - 13311048
Alignment:
| Q |
99 |
aagaccaattacatgatgtaaaaacacaatgaaatgatcaaaacaca |
145 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
13311002 |
aagaccaattacatgattcaaaaacacaagaaaatgatcaaaacaca |
13311048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University