View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8200_high_10 (Length: 334)
Name: NF8200_high_10
Description: NF8200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8200_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 18 - 324
Target Start/End: Complemental strand, 47192244 - 47191938
Alignment:
| Q |
18 |
atagaaacctgaggaatagtttgtttcacttttggatgaaactaaggttgctcgctcattaatttcttggccaggaagaagagtatctgttggaaaatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192244 |
atagaaacctgaggaatagtttgtttcacttttggatgaaactaaggttgctcgctcattaatttcttggccaggaagaagagtatctgttggaaaatca |
47192145 |
T |
 |
| Q |
118 |
aagctttgccaaaggatactaatgttaccgttggtcgtggcgagaacgaggttgccattgttttgaagcttgagctgtaatggaaaaggagaaaaggatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192144 |
aagctttgccaaaggatactaatgttaccgttggtcgtggagagaacgaggttgccattgttttgaagcttgagctgtaatggaaaaggagaaaaggatg |
47192045 |
T |
 |
| Q |
218 |
aagtggaccaaattggtgttctttttctgtctgcatcggttaaaatgagattaccgtttttgaaaagtgagagttttgagtgtttgccgttaacaggttg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192044 |
aagtggaccaaattggtgttctttttctgtctgcatcggttaaaatgagattaccgtttttgaaaagtgagagttttgagtgtttgccgttaacaggttg |
47191945 |
T |
 |
| Q |
318 |
gtctctg |
324 |
Q |
| |
|
||||||| |
|
|
| T |
47191944 |
gtctctg |
47191938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 89 - 128
Target Start/End: Complemental strand, 26693303 - 26693264
Alignment:
| Q |
89 |
caggaagaagagtatctgttggaaaatcaaagctttgcca |
128 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
26693303 |
caggaaggagggtatctgttggaaaatcaaagctttgcca |
26693264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 248 - 320
Target Start/End: Original strand, 26745712 - 26745784
Alignment:
| Q |
248 |
ctgcatcggttaaaatgagattaccgtttttgaaaagtgagagttttgagtgtttgccgttaacaggttggtc |
320 |
Q |
| |
|
|||| |||||||||||||| || || |||||| ||| || ||| ||||| |||| ||||||||||||||||| |
|
|
| T |
26745712 |
ctgcgtcggttaaaatgaggttgccagttttgagaagggaaagtgttgagcgttttccgttaacaggttggtc |
26745784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University