View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8200_high_12 (Length: 325)
Name: NF8200_high_12
Description: NF8200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8200_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 41653721 - 41653957
Alignment:
| Q |
1 |
ctgatctctgctgtacaatggatttgagacatcctctcatgtttgtaggaacttcttatagtaatctcattgtcttcaactttcagaatcctcaggtctt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || |||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
41653721 |
ctgatctctgctgtacaatggatgtgagacatcctctcatggttgtaggaactgctgataggaatcttattgtcttcaacttgcagaatcctcaggtctt |
41653820 |
T |
 |
| Q |
101 |
ataattcattctaaaataaattttcataatgctgttgct--tagctttgtacgaaataggtcggtttccaat------cttataatttttcaacatcatg |
192 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41653821 |
---------------ataaattttcataatgctgttgcttatagctttgtacggaataggtcggtttccaattagttgcttataatttttcaacatcatg |
41653905 |
T |
 |
| Q |
193 |
tgaaatctgctttttctctacgtgagtagttattgatttcaataaatgtcga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653906 |
tgaaatctgctttttctctacgtgagtagttattgatttcaataaatgtcga |
41653957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 25 - 97
Target Start/End: Complemental strand, 28818108 - 28818036
Alignment:
| Q |
25 |
tgagacatcctctcatgtttgtaggaacttcttatagtaatctcattgtcttcaactttcagaatcctcaggt |
97 |
Q |
| |
|
||||||||||||| ||| |||| |||||| | |||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
28818108 |
tgagacatcctctgatggttgtgggaactgccgataggaatctgattgtcttcaacttgcagaatcctcaggt |
28818036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University