View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8200_high_18 (Length: 281)
Name: NF8200_high_18
Description: NF8200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8200_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 16 - 268
Target Start/End: Complemental strand, 51190258 - 51190006
Alignment:
| Q |
16 |
ggagtgatcttaattcttcagatttgttatcattgaatagtgaaatgcttcatgatatgtcaagcactagattctctcctgaatttcatggaatttcaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51190258 |
ggagtgatcttaattcttcagatttgttatcattgaatagtgaaatgcttcatgatatgtcaagcactagattctctcctgaatttcatggaatttcaag |
51190159 |
T |
 |
| Q |
116 |
tgttcattctgatgaagaagaaaattcgtttacggcattgaatcctggtgagaagaggagtatgtctgagatagcaaatgttccaaggtttgtcgaaatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51190158 |
tgttcattctgatgaagaagaaaattcgtttacggcattgaatcctggtgagaagaggagtatgtctgagatagcaaatgttccaaggtttgtcgaaatc |
51190059 |
T |
 |
| Q |
216 |
agtagaagtggggagaatggaagtgatgagaggttgtggaggatttagatgcc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51190058 |
agtagaagtggggagaatggaagtgatgagaggttgtggaggatttggatgcc |
51190006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University