View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8200_low_10 (Length: 381)
Name: NF8200_low_10
Description: NF8200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8200_low_10 |
 |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 291; Significance: 1e-163; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 18 - 364
Target Start/End: Original strand, 7263959 - 7264305
Alignment:
| Q |
18 |
aatccatcattctcttggttagaatattccgcttgagtcctcgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||| || |
|
|
| T |
7263959 |
aatccatcattctcttggttagaatattccgcttgagtccccgtgagcatagctcagctgatagggatatgcattattatatgcagtgtcggaagtttga |
7264058 |
T |
 |
| Q |
118 |
accccaaacactccacttatttacctttttcaccttaaaaatggtgaattttagccattagacaacttgacaaaaagaaaaagaatatcccgcttgaatt |
217 |
Q |
| |
|
| |||||||||| |||||||||||||||||||| |||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7264059 |
atcccaaacacttcacttatttacctttttcactttaaaaattatgaattctagccattagacaacttaacaaaaagaaaaagaatatcccgcttgaatt |
7264158 |
T |
 |
| Q |
218 |
ttagttctgcaatgaattaccgatatccttcctttactcataatggaaatgtaacttgatctctatatatatgtttacttctcgcatgagctataagatt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7264159 |
ttagttctgcaatgaattaccgatatccttcctttactcataatggaaatgtaacttgatctctatatatatgtttacttctcacatgagctataagatt |
7264258 |
T |
 |
| Q |
318 |
tttagctaggcttattgttgatttagtttctactaagagtgtgacta |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7264259 |
tttagctaggcttattgttgatttagtttctactaagagtgtgacta |
7264305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 246 - 359
Target Start/End: Original strand, 7247947 - 7248056
Alignment:
| Q |
246 |
ttcctttactcataatggaaatgtaacttgatctctatatatatgtttacttctcgcatgagctataagatttttagctaggcttattgttgatttagtt |
345 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||| |||||||||||||||||||||||||| | |
|
|
| T |
7247947 |
ttcctttattcataatggaaatgtaacttgatctctata----tgtttacttcttgcatgagctatgagaattttagctaggcttattgttgatttattg |
7248042 |
T |
 |
| Q |
346 |
tctactaagagtgt |
359 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
7248043 |
tccactaagagtgt |
7248056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 144
Target Start/End: Complemental strand, 18102045 - 18101960
Alignment:
| Q |
59 |
cgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
||||||||||| || | |||||| || || ||||||||||||||| | | | |||||||||||| |||| ||||||||| ||||| |
|
|
| T |
18102045 |
cgtgagcatagctcggttgatagagacatgtattattatatgcaggggccggagttcgaaccccagacaccccacttattcacctt |
18101960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 57 - 141
Target Start/End: Complemental strand, 36781983 - 36781900
Alignment:
| Q |
57 |
ctcgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatttac |
141 |
Q |
| |
|
||||||||||||| || ||||||||| || ||||||||||||||| |||||| |||||||||||||| || |||||||||||| |
|
|
| T |
36781983 |
ctcgtgagcatagctcgattgatagggacatgtattattatatgcagggtcgga-gttcgaaccccaaataccccacttatttac |
36781900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 59 - 144
Target Start/End: Original strand, 22660739 - 22660825
Alignment:
| Q |
59 |
cgtgagcatagttcagctgatagggata-tatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||||||||||| ||| ||||||| | ||| ||||||| || | | | |||||||||||||||||| ||||||||||||||| |
|
|
| T |
22660739 |
cgtgagcatagttcagttgacagggataatgcattgttatatgtaggggccggggttcgaaccccaaacaccccacttatttacctt |
22660825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 55 - 135
Target Start/End: Original strand, 3532576 - 3532656
Alignment:
| Q |
55 |
tcctcgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccactt |
135 |
Q |
| |
|
||||||||| | |||||||| || ||||||||| || ||||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
3532576 |
tcctcgtgatcttagttcagttggtagggatattgcataatatatgcaggggccgaggttcgaaccccaaacactccactt |
3532656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 144
Target Start/End: Original strand, 7908739 - 7908793
Alignment:
| Q |
90 |
attattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||||||||| | | |||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
7908739 |
attattatatgcagaggctgaggttcgaaccccaaacaccctacttattcacctt |
7908793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 144
Target Start/End: Complemental strand, 22966023 - 22965969
Alignment:
| Q |
90 |
attattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||||||||| | | ||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
22966023 |
attattatatgcaggggccgaggttcgaaccccagacaccccacttattcacctt |
22965969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 144
Target Start/End: Original strand, 42887184 - 42887238
Alignment:
| Q |
90 |
attattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||||||||| | | |||||||||||||| |||| ||||||||||||||| |
|
|
| T |
42887184 |
attattatatgcaggggctgaggttcgaaccccggacaccccacttatttacctt |
42887238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 66 - 138
Target Start/End: Complemental strand, 8903883 - 8903812
Alignment:
| Q |
66 |
atagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatt |
138 |
Q |
| |
|
||||||||| |||||||||||| ||| |||||||||| |||| ||||||||||||| |||| |||||||| |
|
|
| T |
8903883 |
atagttcagttgatagggatatgcattgttatatgcaggatcgg-ggttcgaaccccagacacatcacttatt |
8903812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 54 - 138
Target Start/End: Original strand, 47355803 - 47355887
Alignment:
| Q |
54 |
gtcctcgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatt |
138 |
Q |
| |
|
|||||||||| |||| ||||| ||| |||||||| ||| |||||||||| | | | ||||||||||||| ||| ||||||||| |
|
|
| T |
47355803 |
gtcctcgtgaacataattcagatgacagggatatgcattgttatatgcaggggccggggttcgaaccccagacatcccacttatt |
47355887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 89 - 144
Target Start/End: Original strand, 21752827 - 21752882
Alignment:
| Q |
89 |
tattattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
||||||||||||||| | | | |||| ||||||||||||||||||||||||||||| |
|
|
| T |
21752827 |
tattattatatgcaggggctggggtttgaaccccaaacactccacttatttacctt |
21752882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 57 - 138
Target Start/End: Complemental strand, 34773781 - 34773700
Alignment:
| Q |
57 |
ctcgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatt |
138 |
Q |
| |
|
|||||||||||||||||| ||||||| || |||||||||||||| | | |||||||||||||| |||| ||||||||| |
|
|
| T |
34773781 |
ctcgtgagcatagttcagttgataggacaatgcattattatatgcaggggctgaggttcgaaccccggacaccccacttatt |
34773700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 144
Target Start/End: Complemental strand, 9285724 - 9285670
Alignment:
| Q |
90 |
attattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||||||||| ||| | ||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
9285724 |
attattatatgcagggtctggggttcgaaccccagacaccccacttattaacctt |
9285670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 61 - 138
Target Start/End: Original strand, 21664080 - 21664156
Alignment:
| Q |
61 |
tgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatt |
138 |
Q |
| |
|
||||||||| |||| || ||||||||| ||| ||||||||||| | | |||||||||| |||| ||| |||||||||| |
|
|
| T |
21664080 |
tgagcatagctcagttggtagggatatgtataattatatgcaggggctgaggttcgaatcccagaca-tccacttatt |
21664156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 61 - 138
Target Start/End: Original strand, 21672844 - 21672920
Alignment:
| Q |
61 |
tgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatt |
138 |
Q |
| |
|
||||||||| |||| || ||||||||| ||| ||||||||||| | | |||||||||| |||| ||| |||||||||| |
|
|
| T |
21672844 |
tgagcatagctcagttggtagggatatgtataattatatgcaggggctgaggttcgaatcccagaca-tccacttatt |
21672920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 60 - 133
Target Start/End: Original strand, 37728939 - 37729012
Alignment:
| Q |
60 |
gtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccac |
133 |
Q |
| |
|
||||||||||||||| || ||||||||| |||||||||||||| | ||||||||||| || ||||||||| |
|
|
| T |
37728939 |
gtgagcatagttcagttggtagggatatgcattattatatgcaggggtcgaggttcgaactccggacactccac |
37729012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 71 - 138
Target Start/End: Original strand, 2995189 - 2995256
Alignment:
| Q |
71 |
tcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatt |
138 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| | ||| |||||||| ||||||| ||||||||| |
|
|
| T |
2995189 |
tcagttgatagggatatgtattattatatgcaggggtcgagattcgaacctcaaacaccccacttatt |
2995256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 135
Target Start/End: Complemental strand, 34898835 - 34898759
Alignment:
| Q |
59 |
cgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccactt |
135 |
Q |
| |
|
||||||| |||||||| || ||||||||| |||||||||||| | | ||||||||||||||| |||| |||||| |
|
|
| T |
34898835 |
cgtgagcttagttcagttggtagggatattgcatattatatgcaggggctgaggttcgaaccccagacaccccactt |
34898759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 146 - 198
Target Start/End: Original strand, 51975158 - 51975210
Alignment:
| Q |
146 |
ttcaccttaaaaatggtgaattttagccattagacaacttgacaaaaagaaaa |
198 |
Q |
| |
|
|||||||||| || | ||||||||| || ||||||||||||||||||| |||| |
|
|
| T |
51975158 |
ttcaccttaataaagatgaattttaaccgttagacaacttgacaaaaaaaaaa |
51975210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 57 - 138
Target Start/End: Original strand, 4320 - 4401
Alignment:
| Q |
57 |
ctcgtgagcatagttcagctgatagggatatatattattatatgca-gtgtcggaggttcgaaccccaaacactccacttatt |
138 |
Q |
| |
|
||||||||||||| |||| ||||||| ||| ||||||||||||| | ||||| |||||||||||| |||||||||||||| |
|
|
| T |
4320 |
ctcgtgagcatagctcagttgataggacaatacattattatatgcaggggtcgg-ggttcgaaccccggacactccacttatt |
4401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 144
Target Start/End: Original strand, 1029 - 1123
Alignment:
| Q |
50 |
ttgagtcctcgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||| ||||||||||| |||| || |||||| || || |||||||| || | | | ||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
1029 |
ttgagtccccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttattcacctt |
1123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 144
Target Start/End: Complemental strand, 10199807 - 10199753
Alignment:
| Q |
90 |
attattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||||||||| | | | |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
10199807 |
attattatatgcaggggccggggttcgaaccccaaacaccccacttattcacctt |
10199753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 54 - 144
Target Start/End: Original strand, 17467272 - 17467361
Alignment:
| Q |
54 |
gtcctcgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
||||| ||||||||| |||| || |||||||||| |||||||||||||| | | | |||||||||||| |||| ||||||||| ||||| |
|
|
| T |
17467272 |
gtccttgtgagcataactcagttggtagggatatacattattatatgcaggggccg-ggttcgaaccccggacaccccacttattcacctt |
17467361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 144
Target Start/End: Complemental strand, 30942664 - 30942610
Alignment:
| Q |
90 |
attattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||||||||| | | | |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
30942664 |
attattatatgcaggggccggggttcgaaccccgaacaccccacttatttacctt |
30942610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 144
Target Start/End: Complemental strand, 26669764 - 26669670
Alignment:
| Q |
50 |
ttgagtcctcgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||| ||||||||||| |||| || |||||| || || |||||||| || | | | ||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
26669764 |
ttgagtccccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttattcacctt |
26669670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 9302620 - 9302665
Alignment:
| Q |
160 |
ggtgaattttagccattagacaacttgacaaaaagaaaaagaatat |
205 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||| |||||| |
|
|
| T |
9302620 |
ggtgaattttagccattagactacctgacaaaaaaaaaatgaatat |
9302665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 54 - 144
Target Start/End: Original strand, 1244563 - 1244653
Alignment:
| Q |
54 |
gtcctcgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||| ||| ||||||||| | || |||||||||||| |||| ||||||||| ||||| |
|
|
| T |
1244563 |
gtcctcgtgagcatagttcagttggcagggacatacattgctatatgcaggggtgggggttcgaaccccggacaccccacttattcacctt |
1244653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 144
Target Start/End: Complemental strand, 30474260 - 30474206
Alignment:
| Q |
90 |
attattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||||||||| | | ||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
30474260 |
attattatatgcaggggccgaggttcgaaccccagacaccccacttattcacctt |
30474206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 142 - 199
Target Start/End: Complemental strand, 21874993 - 21874934
Alignment:
| Q |
142 |
ctttttcaccttaaaaatggtgaattttagc--cattagacaacttgacaaaaagaaaaa |
199 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| || ||| | |||||||||||||||||| |
|
|
| T |
21874993 |
ctttttcaccttcaaaatggtgaattctagccacactaggctacttgacaaaaagaaaaa |
21874934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 55 - 135
Target Start/End: Complemental strand, 44857306 - 44857226
Alignment:
| Q |
55 |
tcctcgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccactt |
135 |
Q |
| |
|
||||||||||| ||| |||| || ||||||||| |||||||||||| | | |||||||||||||| ||||||||||| |
|
|
| T |
44857306 |
tcctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacactccactt |
44857226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 144
Target Start/End: Original strand, 21884605 - 21884659
Alignment:
| Q |
90 |
attattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
|||||||||||||| | | ||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
21884605 |
attattatatgcaggggccgaggttcgaaccccagacaccccacttattcacctt |
21884659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 146 - 199
Target Start/End: Original strand, 19866552 - 19866605
Alignment:
| Q |
146 |
ttcaccttaaaaatggtgaattttagccattagacaacttgacaaaaagaaaaa |
199 |
Q |
| |
|
||||||||||||| |||||||| |||||| || || |||||||||||| ||||| |
|
|
| T |
19866552 |
ttcaccttaaaaaaggtgaattctagccactaaactacttgacaaaaaaaaaaa |
19866605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 146 - 198
Target Start/End: Original strand, 1721217 - 1721269
Alignment:
| Q |
146 |
ttcaccttaaaaatggtgaattttagccattagacaacttgacaaaaagaaaa |
198 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||| | |||||||||||| |||| |
|
|
| T |
1721217 |
ttcaccttaaaaaaggtgaattctagccgttaggctacttgacaaaaaaaaaa |
1721269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 135
Target Start/End: Original strand, 11215003 - 11215079
Alignment:
| Q |
59 |
cgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccactt |
135 |
Q |
| |
|
||||||| ||| |||| || ||||||||| |||||||||||| | | ||||||||||||||| ||||||||||| |
|
|
| T |
11215003 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgaggttcgaaccccagacactccactt |
11215079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 90 - 138
Target Start/End: Complemental strand, 16110085 - 16110037
Alignment:
| Q |
90 |
attattatatgcagtgtcggaggttcgaaccccaaacactccacttatt |
138 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
16110085 |
attattatatgcaggggttgaggttcgaaccccaaagactccacttatt |
16110037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 135
Target Start/End: Complemental strand, 18467266 - 18467190
Alignment:
| Q |
59 |
cgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccactt |
135 |
Q |
| |
|
||||||||||| |||| || ||||||||| |||||||||||| | | | ||||||||||||| ||||||||||| |
|
|
| T |
18467266 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccactt |
18467190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 144
Target Start/End: Original strand, 101830 - 101915
Alignment:
| Q |
59 |
cgtgagcatagttcagctgatagggatatatattattatatgcagtgtcggaggttcgaaccccaaacactccacttatttacctt |
144 |
Q |
| |
|
||||||||||| ||||||| |||| || |||||||||||||| | | | ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
101830 |
cgtgagcatagctcagctggtaggataatgcattattatatgcaggggccggggttcgaaccccaaacatcccacttattcacctt |
101915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University