View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8200_low_25 (Length: 264)
Name: NF8200_low_25
Description: NF8200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8200_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 123 - 247
Target Start/End: Original strand, 25601031 - 25601155
Alignment:
| Q |
123 |
aatccacttggattaatataatttgttagataataaaacatagggcttaagttacaaaacaatcaatcatcaacgatatacaaagttgaaaaaatagctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
25601031 |
aatccacttggattaatataatttgttagataataaaatatagggcttaagttataaaacaatcaatcaacaatgatatacaaagttgaaaaaatagctt |
25601130 |
T |
 |
| Q |
223 |
tcattcaattttgtaatgtgaggat |
247 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
25601131 |
tcattcaattttgtaatgtgaggat |
25601155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 91
Target Start/End: Original strand, 25600958 - 25601030
Alignment:
| Q |
19 |
aaggtaaggagtgatgtgaacttgcataaacatactttgcactccactaggatcttaacaatctcgatcacca |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25600958 |
aaggtaaggagtgatgtgaacttgcataaacacactttgcactccactagaatcttaacaatctcgatcacca |
25601030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 5 - 94
Target Start/End: Complemental strand, 48587090 - 48587000
Alignment:
| Q |
5 |
atgaaaccgcaaagaaggtaaggagtgatgtgaacttgcataaacatactttgca-ctccactaggatcttaacaatctcgatcaccactt |
94 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||| ||| |||| || || |||||| ||||||| |||||||||||| |
|
|
| T |
48587090 |
atgaaactgcaaagaaggtaaggaatgatgtgaacttgcataaacacactctgcagctttaccaggatcccaacaatcccgatcaccactt |
48587000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 40184062 - 40184022
Alignment:
| Q |
96 |
atataaaatgccaactatgattattctaatccacttggatt |
136 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
40184062 |
atataaaatgtcaactatgattattttaatccacttggatt |
40184022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University