View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8200_low_33 (Length: 248)
Name: NF8200_low_33
Description: NF8200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8200_low_33 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 51846556 - 51846797
Alignment:
| Q |
1 |
gatagaggaattacaagtttaaagatgaatatgatcaatttttatgtcaatgtcaatgtcaatgtcaatatgctagcttagtatgtaacagttgcttttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51846556 |
gatagaggaattacaagtttaaagatgaatatgatcaatttttatgt------caatgtcaatgtcaatatgctagcttagtatgtaacagttgcttttg |
51846649 |
T |
|
| Q |
101 |
taggtgagagttgcagtcctaggaaagattaattaattcaattgattcagcatcttgaaccaacaatgaagtattcatgaatgatcctctcaaagcttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51846650 |
taggtgagagttgcagtcctaggaaagattaattaattcaattgattcagcatcttgaaccaacaatgaagtattcatgaatgatcctctcaaagcttag |
51846749 |
T |
|
| Q |
201 |
cggtgaacaatgagttttgcacaacactacatatattaaagggcatct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51846750 |
cggtgaacaatgagttttgcacaacactacatatattaaagggcatct |
51846797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University