View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8202_high_14 (Length: 243)
Name: NF8202_high_14
Description: NF8202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8202_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 35 - 224
Target Start/End: Complemental strand, 42168854 - 42168669
Alignment:
| Q |
35 |
tgattgtcaaacaaagaagcgacacgtggctactatattttgtgtctatcttagtgccgcagtggaaaaagggaagtttggtgcaacgattatttatgac |
134 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42168854 |
tgattatcaaacaaagaagcgacacgtggctgctatattttgtgtctatcttagtgccgcagtggaaaaagggaagtttggtgcaacgattatttatgac |
42168755 |
T |
|
| Q |
135 |
ctcggaactaactatctatcatattcatcatgtgattccaaggacctttgattgatgattctaaggatattccattttggggtccgattc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42168754 |
ctcggaactaactatctatcatattcatcatgtgattccaaggacctt----tgatgattctaaggatattccattttggggtccgattc |
42168669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University