View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8202_high_20 (Length: 223)
Name: NF8202_high_20
Description: NF8202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8202_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 38744054 - 38743859
Alignment:
| Q |
16 |
agatatgcttgtgtaaaattgttgaattttataaaaacaatccaatctaatgtttttctaggtacaacaaaatccaacgtaaagtttgcatacatagaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38744054 |
agatatgcttgtgtaaaattgttgaattttataaaaacaatccaatctaatgtttttctaggtacaacaaaatccaacgtaaagtttgcatacatagaag |
38743955 |
T |
 |
| Q |
116 |
taaaatttatagcaaaaatatttttacatgcattcagaat-----acataaatagagaacggtgttgagttt-tttatgttaatgatatggattta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
38743954 |
taaaatttatagcaaaaatatttttacatgcattcagaatatataaaataaatagagaacggtgttgagtttctttatgttaataatatggattta |
38743859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University