View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8202_high_21 (Length: 212)
Name: NF8202_high_21
Description: NF8202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8202_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 43 - 192
Target Start/End: Original strand, 38838116 - 38838265
Alignment:
| Q |
43 |
tttttagagttatctatcgaattttttaaatgtctaagagacgttgaaaggaccaaaaagaattgctcatttctctatctattccctttgggcaacattt |
142 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38838116 |
ttttgagagttatctttcgaattttttaaatgcctaagagacgttgaaaggaccaaaaagaattgctcatttctctatctattccctttgggcaacattt |
38838215 |
T |
|
| Q |
143 |
atcactaaagcccattttccagctagagtatgtatacgatactcacacgg |
192 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38838216 |
atcactaaagcccgttttccagctagagtatgtatacgatgctcacacgg |
38838265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 38838000 - 38838032
Alignment:
| Q |
17 |
gtggtccaatttctttggaggatttctttttag |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38838000 |
gtggtccaatttctttggaggatttctttttag |
38838032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University