View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8202_low_25 (Length: 224)

Name: NF8202_low_25
Description: NF8202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8202_low_25
NF8202_low_25
[»] chr8 (2 HSPs)
chr8 (19-163)||(128136-128280)
chr8 (160-208)||(126734-126782)
[»] chr3 (1 HSPs)
chr3 (160-208)||(33058415-33058463)


Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 163
Target Start/End: Complemental strand, 128280 - 128136
Alignment:
19 gacagaatgaaccaaatttgcctagtatttggctttttaatatgacaacctttcacaaattcaaaaatgggtaacgtaaataacatttatgagaacgagt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
128280 gacagaatgaaccaaatttgcctagtatttggctttttaatatgacaacctttcacaaattcaaaaatgggtaacgtaaataacatttatgagaacgagt 128181  T
119 tcattatactacttttattcccgagtacacctgaatagttttttg 163  Q
    ||||||||||||||||||||||| |||||||||||||||||||||    
128180 tcattatactacttttattcccgtgtacacctgaatagttttttg 128136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 126782 - 126734
Alignment:
160 tttgcagttaaaaaatcaaaatcaaacccttacaacattagcatttcat 208  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||    
126782 tttgcagttaaaaaatcaaaatcaaatccttacaacattagcatttcat 126734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 33058463 - 33058415
Alignment:
160 tttgcagttaaaaaatcaaaatcaaacccttacaacattagcatttcat 208  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||    
33058463 tttgcagttaaaaaatcaaaatcaaatccttacaacattagcatttcat 33058415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University