View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8202_low_25 (Length: 224)
Name: NF8202_low_25
Description: NF8202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8202_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 163
Target Start/End: Complemental strand, 128280 - 128136
Alignment:
| Q |
19 |
gacagaatgaaccaaatttgcctagtatttggctttttaatatgacaacctttcacaaattcaaaaatgggtaacgtaaataacatttatgagaacgagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
128280 |
gacagaatgaaccaaatttgcctagtatttggctttttaatatgacaacctttcacaaattcaaaaatgggtaacgtaaataacatttatgagaacgagt |
128181 |
T |
|
| Q |
119 |
tcattatactacttttattcccgagtacacctgaatagttttttg |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
128180 |
tcattatactacttttattcccgtgtacacctgaatagttttttg |
128136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 126782 - 126734
Alignment:
| Q |
160 |
tttgcagttaaaaaatcaaaatcaaacccttacaacattagcatttcat |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
126782 |
tttgcagttaaaaaatcaaaatcaaatccttacaacattagcatttcat |
126734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 33058463 - 33058415
Alignment:
| Q |
160 |
tttgcagttaaaaaatcaaaatcaaacccttacaacattagcatttcat |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33058463 |
tttgcagttaaaaaatcaaaatcaaatccttacaacattagcatttcat |
33058415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University