View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8203_high_4 (Length: 368)
Name: NF8203_high_4
Description: NF8203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8203_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 5e-72; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 221 - 362
Target Start/End: Complemental strand, 45445519 - 45445378
Alignment:
| Q |
221 |
ggtgacgagggtgattggaatgtggagcacactcacttaagtatttttaaacttgttcatacattttagtccaatggatgatattaactcctctcatata |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45445519 |
ggtgacgagggtgattggaatgtggagcacactcacttaagtatttttaaacttgttcatacattttagtccaatggatgatattaactcctctcatata |
45445420 |
T |
|
| Q |
321 |
aatatatatcttttgacattagctgtgtcgtgtctgatgtcc |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45445419 |
aatatatatcttttgacattagctgtgtcgtgtctggtgtcc |
45445378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 93 - 221
Target Start/End: Complemental strand, 45445725 - 45445597
Alignment:
| Q |
93 |
agagccctctttaaatggaagatttgttatttgcctctttaattgatccaatgattgttcctttgcctcttggagcttctttatcatgtgtaaatcgtgc |
192 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45445725 |
agagccctctttaaatggaatatttgttatttgcctctttaattgatccaatgattgttcctttgcctcttggagcttctttatcatgtgtaaatcgtgc |
45445626 |
T |
|
| Q |
193 |
agctaacaatataaggagtgtgtgaatcg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45445625 |
agctaacaatataaggagtgtgtgaatcg |
45445597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 45445817 - 45445779
Alignment:
| Q |
1 |
tttacgtcattagagttgcaatcaaaatacattgattcg |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45445817 |
tttacgtcattagagttgcaatcaaaatacattgattcg |
45445779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University