View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8204_low_10 (Length: 361)
Name: NF8204_low_10
Description: NF8204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8204_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 178 - 346
Target Start/End: Complemental strand, 47232381 - 47232213
Alignment:
| Q |
178 |
aaatcaatacatgatagaaaaatttatgatttataaaattttgaatttaatattgaattcatcttttaaagttaagtttaatgtattagttattgtataa |
277 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47232381 |
aaatcaatacatgatagcaaaatttatgatttataaaattttgaatttaatattgaattcatcttttaaagttaagtttaatgtattagttattgtataa |
47232282 |
T |
 |
| Q |
278 |
ttttcctcaaattttttactatatattttggtttcattgccnnnnnnngtaatggattggagatatttt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
47232281 |
ttttcctcaaattttttactatatattttggttttattgcctttttttgtaatggattggagatatttt |
47232213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 47232556 - 47232463
Alignment:
| Q |
1 |
aaactctacttttgaagattatgataagcattatgaagattaaacattattgttgtttttatatagtttattccactttagaatgcatgtaata |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47232556 |
aaactctacttttgaagattatgataagcattatgaagattaaacattattgttgtttttatatagtttattccactttagaatgcatttaata |
47232463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University