View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8204_low_22 (Length: 259)

Name: NF8204_low_22
Description: NF8204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8204_low_22
NF8204_low_22
[»] chr3 (1 HSPs)
chr3 (8-241)||(51934305-51934536)
[»] chr5 (2 HSPs)
chr5 (124-235)||(12994607-12994718)
chr5 (124-235)||(13069256-13069367)
[»] chr8 (1 HSPs)
chr8 (124-235)||(28136714-28136825)


Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 241
Target Start/End: Complemental strand, 51934536 - 51934305
Alignment:
8 tgaattggaaaattatgaaataactacagattgaaatcattggttatattactaactatattatatcattcaagaatcagggattaaggcttactaatag 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||||||||||||    
51934536 tgaattggaaaattatgaaataactacagattgaaatcattggttatattactgactat--tatatcattcaagaatcagggattaaggcttactaatag 51934439  T
108 tttggagcttttgatcttgcagagaatactcgtgcagcgtatcctatagagtacatacctaatgctaggataccatgtgttgctccccatgcaaagaatg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51934438 tttggagcttttgatcttgcagagaatactcgtgcagcgtatcctatagagtacatacctaatgctaggataccatgtgttgctccccatgcaaagaatg 51934339  T
208 tcatccttctagcttgtgatgcatttggggtact 241  Q
    ||||||||||||||||||||||||||||||||||    
51934338 tcatccttctagcttgtgatgcatttggggtact 51934305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 124 - 235
Target Start/End: Complemental strand, 12994718 - 12994607
Alignment:
124 ttgcagagaatactcgtgcagcgtatcctatagagtacatacctaatgctaggataccatgtgttgctccccatgcaaagaatgtcatccttctagcttg 223  Q
    ||||||| |||||||||||||| |||||||||||||||||||| ||||| | | ||||||||||||  || ||| |||||||||| || ||| | || ||    
12994718 ttgcagaaaatactcgtgcagcctatcctatagagtacataccaaatgcaaagttaccatgtgttggacctcatccaaagaatgttattcttttggcatg 12994619  T
224 tgatgcatttgg 235  Q
    ||||||||||||    
12994618 tgatgcatttgg 12994607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 124 - 235
Target Start/End: Complemental strand, 13069367 - 13069256
Alignment:
124 ttgcagagaatactcgtgcagcgtatcctatagagtacatacctaatgctaggataccatgtgttgctccccatgcaaagaatgtcatccttctagcttg 223  Q
    ||||||| |||||||||||||| |||||||||||||||||||| ||||| | | ||||||||||||  || ||| |||||||||| || ||| | || ||    
13069367 ttgcagaaaatactcgtgcagcctatcctatagagtacataccaaatgcaaagttaccatgtgttggacctcatccaaagaatgttattcttttggcatg 13069268  T
224 tgatgcatttgg 235  Q
    ||||||||||||    
13069267 tgatgcatttgg 13069256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 235
Target Start/End: Complemental strand, 28136825 - 28136714
Alignment:
124 ttgcagagaatactcgtgcagcgtatcctatagagtacatacctaatgctaggataccatgtgttgctccccatgcaaagaatgtcatccttctagcttg 223  Q
    ||||||| |||||||||||||| ||||| || |||||||| ||||| || | | |||||||||||| ||| ||  ||||||||||||| ||| | || ||    
28136825 ttgcagaaaatactcgtgcagcttatccaattgagtacattcctaacgcaaagttaccatgtgttggtcctcacccaaagaatgtcatacttttggcatg 28136726  T
224 tgatgcatttgg 235  Q
    ||||||||||||    
28136725 tgatgcatttgg 28136714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University