View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8204_low_25 (Length: 251)
Name: NF8204_low_25
Description: NF8204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8204_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 63 - 240
Target Start/End: Original strand, 31935885 - 31936062
Alignment:
| Q |
63 |
ctgaaatgaccctgaaccgccactagtttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatctggcgaactatttcctaga |
162 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935885 |
ctgacatgaacctgaaccgccactagtttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatctggcgaactatttcctaga |
31935984 |
T |
|
| Q |
163 |
gtgaattctgctaatgttgccggtggtgttgcaccgttaccgttgcagttaatttctccggaaccacagtcacaggtt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31935985 |
gtgaattctgctaatgttgccggtggtgttgcaccgttaccattgcagttaatttctccggaaccacagtcaccggtt |
31936062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 144
Target Start/End: Original strand, 27975632 - 27975686
Alignment:
| Q |
90 |
ttcaaccatcaccggaagattgtaaccgtctacgagactaacgtcatagtaatct |
144 |
Q |
| |
|
|||||| |||| |||||||||||||||||| |||||||| ||||| ||| ||||| |
|
|
| T |
27975632 |
ttcaactatcatcggaagattgtaaccgtcgacgagactcacgtcgtagaaatct |
27975686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University