View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8205_low_5 (Length: 211)
Name: NF8205_low_5
Description: NF8205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8205_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 32825985 - 32826161
Alignment:
| Q |
18 |
agaatggagtacttgttttccacaaactcaaagattaatttgcaagatnnnnnnnnnnntctcaaagagatagtagacagataaaagaacaatttcgcga |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
32825985 |
agaatggagtacttgttttgcacaaactcagagattaatttgcaagataaaaaaaaa--tctca--gagatagtagacagatagaagaacaatttcgcga |
32826080 |
T |
 |
| Q |
118 |
atggtggtgagatcttggcgttgatagtgggcaatggtaagggtgtatccgcatgtatttcaacgtttaagtcagtataat |
198 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
32826081 |
atggtggtgagatcatggcattgatagtgggcaatggtaatggtgtatccgcatgtatttcaacgttcaagtcaatataat |
32826161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University