View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_110 (Length: 253)
Name: NF8206A_low_110
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_110 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 34042117 - 34042005
Alignment:
| Q |
16 |
gacatcatggattgcaatatactaataataggtcacagtcacagcttttgccatttaaaatcagtcaacagacataatagacctcaaaaatcttgactat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34042117 |
gacatcatggattgcaatatactaataataggtcacagtcacagcttttgccatttaaaatcagtcaacagacataatagacctcaaaaatcttgactat |
34042018 |
T |
 |
| Q |
116 |
caattgtagtttt |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34042017 |
caattgtagtttt |
34042005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 136 - 253
Target Start/End: Complemental strand, 34041280 - 34041163
Alignment:
| Q |
136 |
tgcagaataacgatgtctctttaaaagtattattatggggtgaattctacttcattttttagtggattaacttgatgaatctataattggatggagggtt |
235 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
34041280 |
tgcagaataacgatgtctgtttaaa-gtattattatggggtgaattctacttcattttttagtggatgaacttgatgaatttataattggatggagggtt |
34041182 |
T |
 |
| Q |
236 |
gg-taattggatcaaattg |
253 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
34041181 |
ggttaattggatcaaattg |
34041163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University