View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_124 (Length: 249)
Name: NF8206A_low_124
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_124 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 249
Target Start/End: Complemental strand, 35450052 - 35449810
Alignment:
| Q |
7 |
tttggtgttagtacttcaatcattgattgatcaataattggtgaagaaacaatgctttcttcacaatctgatgaagacaaagaaaaaccattgtttgagt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35450052 |
tttggtgttagtacttcaatcattgattgatcaataattggtgaagaaacaatgctttcttcacaatctgaagaagacaaagaaaaaccattgtttgagt |
35449953 |
T |
 |
| Q |
107 |
caattccttttcttgtaacttgttcatcttcaatgcttgaaactccggaaagtggagcattttgttgttgatggaaaactagcttttccaagagaagtct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449952 |
caattccttttcttgtaacttgttcatcttcaatgcttgaaactccggaaagtggatcattttgttgttgatggaaaactagcttttccaagagaagtct |
35449853 |
T |
 |
| Q |
207 |
ttcacatttttcttgtgcttcatctctttctctaatgatgttg |
249 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449852 |
ttgacatttttcttgtgcttcatctctttctctaatgatgttg |
35449810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 21010633 - 21010701
Alignment:
| Q |
171 |
ttgttgatggaaaactagcttttccaagagaagtctttcacatttttcttgtgcttcatctctttctct |
239 |
Q |
| |
|
|||||| ||||||| || |||||| |||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21010633 |
ttgttgttggaaaagtaacttttctaagaaaagtctttggcatttttcttgtgcttcatctctttctct |
21010701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University