View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_134 (Length: 245)
Name: NF8206A_low_134
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_134 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 27 - 227
Target Start/End: Original strand, 19190419 - 19190619
Alignment:
| Q |
27 |
tctggtcgtggttatggtgctaatgctcgttatgagagtggatatgggcggtctgggggtggatatggtgatggagggcgtgggagtattggtggatatg |
126 |
Q |
| |
|
|||||| |||||||||| ||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19190419 |
tctggtggtggttatggcgctaatgaccgttatgagagtggatatgggcgttctggtggtggatatggtgatggagggcgttcgagtattggtggatatg |
19190518 |
T |
|
| Q |
127 |
gcgaagaaaaccgttctagtggtggctatggatatggagggcgttctagtggttacggtaatgagcaaagttttggagggtatggtagggatggtcgtga |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190519 |
gcgaagaaaaccgttctagtggtggctatggatatggagggcgttctagtggttacggtaatgagcaaagttttggagggtatggtagggatggtcgtga |
19190618 |
T |
|
| Q |
227 |
t |
227 |
Q |
| |
|
| |
|
|
| T |
19190619 |
t |
19190619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University