View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_140 (Length: 244)
Name: NF8206A_low_140
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_140 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 38815437 - 38815667
Alignment:
| Q |
16 |
caccacacaa-gaggcccttcacggctatttagatctctaggctgtgtaggactaacccagcctctcacacccagcaaaattaaggtgctcgaagctgca |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815437 |
caccacacaaagaggcccttcacggctatttagatctctaggctgtgtaggactaacccagcctctcacacccagcaaaattaaggtgctcgaagctgca |
38815536 |
T |
|
| Q |
115 |
atgaaggaaatttaaaagccaaatttaagatggctaggggcagaccacaatcaaggcaaaatttccaaca--ctgcctcacaacctggcctaaattgggc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| | |
|
|
| T |
38815537 |
atgaaggaaatttaaaagccaaatttaagatggctaggggaagaccacaatcaaggcaaaatttccaacaccctgcctcacaacctggcataaattggac |
38815636 |
T |
|
| Q |
213 |
taggggcatggacaatgcgggcagtccaaca |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38815637 |
taggggcatggacaatgcgggcagtccaaca |
38815667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University