View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_141 (Length: 244)
Name: NF8206A_low_141
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_141 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 21 - 224
Target Start/End: Complemental strand, 22362303 - 22362097
Alignment:
| Q |
21 |
attctccgctcaaaatacctgatatcggtgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccttacatactttaaccatgatcttgctg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
22362303 |
attctccgctcaaaatacctgatatcggtgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccttacatattttaaccatgatattgctg |
22362204 |
T |
|
| Q |
121 |
---ggttcttattcatcttttctttttcatgcgttgtgtatgttagggatcaatgatggcaccacatgtgaatccaagtgcaacagaatataccatagtc |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22362203 |
ctgggttcttattcatcttttctatttcatgcattgtgtatgttagggatcaatgatggcaccacatgtgaatccaagtgcaacagagtataccatagta |
22362104 |
T |
|
| Q |
218 |
ttaagag |
224 |
Q |
| |
|
||||||| |
|
|
| T |
22362103 |
ttaagag |
22362097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 224
Target Start/End: Original strand, 39814908 - 39814970
Alignment:
| Q |
162 |
agggatcaatgatggcaccacatgtgaatccaagtgcaacagaatataccatagtcttaagag |
224 |
Q |
| |
|
||||||| |||||| |||| ||||| |||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
39814908 |
agggatccatgatgacaccccatgtaaatccaagggcaacagagtatggcatagtcttaagag |
39814970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University