View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_153 (Length: 239)
Name: NF8206A_low_153
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_153 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 11 - 115
Target Start/End: Complemental strand, 42984184 - 42984080
Alignment:
| Q |
11 |
gaaccaccaacttctaagagctaggagttggacgtggagctatggcgaattggcgatgatctgctgccgggcatacaccatcaaatgacaatcaaccaaa |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42984184 |
gaaccaccaacttctaagatctaggagttggacgtggagctatggcgaattggcgatgatctgctgccgggcatacaccatcaaatgataatcaaccaaa |
42984085 |
T |
 |
| Q |
111 |
agcat |
115 |
Q |
| |
|
||||| |
|
|
| T |
42984084 |
agcat |
42984080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 146 - 223
Target Start/End: Complemental strand, 42984080 - 42984003
Alignment:
| Q |
146 |
tcgccatgactccacattacaaagagaatcttgcataactttattgtcaagacgagaatcgctcatgccctatgatgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984080 |
tcgccatgactccacattacaaagagaatcttgcgtaactttattgtcaagacgagaatcgctcatgccctatgatgt |
42984003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University