View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_156 (Length: 237)
Name: NF8206A_low_156
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_156 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 22 - 204
Target Start/End: Original strand, 17811967 - 17812148
Alignment:
| Q |
22 |
catggttccgttgagtcgtctgttgcaggttcttctccactggaagggggatggtgtacctgcactgcacgcgctccgacactctctttcttgaacccct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| | |||| |||| ||||||||||||||||| |
|
|
| T |
17811967 |
catggttccgttgagtcgtctgttgcaggttcttctccaccggaaggggggtggtgtacctgcactgcatgtgctctgaca--ctctttcttgaacccct |
17812064 |
T |
|
| Q |
122 |
cacttctccagccatctatgcctggggtacggacatgagtca-ccctcggggtggtaaggagctctcggattaatggtgaggaa |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17812065 |
cacttctccagccatctattcctggggtacggacatgagtaacccctcggggtggtgaggagctctcggattaatggtgaggaa |
17812148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University