View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_175 (Length: 229)
Name: NF8206A_low_175
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_175 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 6917656 - 6917429
Alignment:
| Q |
1 |
ttattattgaataataagtctgtgcatttagcattttatattgagtgtgctcaaacaacaagcaaaaggaaaatcagaacctatatgtttcggaatcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
6917656 |
ttattattgaataataagtctgtgcatttagcattttatattgagtgtgctcaaacaacaagcaaatggaaaatcagaacctatatgtttcgaaatcaac |
6917557 |
T |
 |
| Q |
101 |
ctcgccgcgctcaatcttgatggcctggaacttgcctttctggacagttgtgacctctgtatggggagcgaagtgctcccggcttcaaactcgtctccgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917556 |
ctcgccgcgctcaatcttgatggcctggaacttgccattctggacagttgtgacctctgtatggggagcgaagtgctcccggcttcaaactcgtctccgg |
6917457 |
T |
 |
| Q |
201 |
atagtacctgtttcctgttgcagaactg |
228 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
6917456 |
atagtacctgttccctgttgcagaactg |
6917429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University