View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_187 (Length: 224)
Name: NF8206A_low_187
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_187 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 22 - 187
Target Start/End: Original strand, 31798693 - 31798862
Alignment:
| Q |
22 |
gctttgtcataagattttcatggaccatccattatttcgtgattgaacttgaatcttcaaattgcctacttgaattcctatt--nnnnnnnnnnctactt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
31798693 |
gctttgtcataagattttcatggaccatccattatttcgtgattgaacttgaatctacaaattgcctacttgaattcctattaaaaaaaaaaaactactt |
31798792 |
T |
|
| Q |
120 |
gaattatat--aaacaaaatcttgcaagaattgttctactgagcaatcgaactagcaattaaaatcaatt |
187 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31798793 |
gaattatataaaaaaaaaatcttgcaagaattgttctactgagcaatcgaactagtaattaaaatcaatt |
31798862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University