View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8206A_low_200 (Length: 217)

Name: NF8206A_low_200
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8206A_low_200
NF8206A_low_200
[»] chr4 (1 HSPs)
chr4 (31-217)||(32780935-32781121)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 31 - 217
Target Start/End: Original strand, 32780935 - 32781121
Alignment:
31 agacggattattattagtttatggcgaggtcgaggcaaaaatcatcgaaccaggattcttcattatcgccgactgcggcaagatcaagggaatgggatgg 130  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32780935 agacggattattattagtttatggcgaagtcgaggcaaaaatcatcgaaccaggattcttcattatcgccgactgcggcaagatcaagggaatgggatgg 32781034  T
131 gccatctagatgggcagactaccttggaacagaaacgaatacggcttctccattgtcgtcaaccagctccaggaatttcggtcatga 217  Q
     ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
32781035 tccatctagatgggcagactaccttggaacagaaacaaatacggcttctccattgtcgtcaaccagctccaggaatttcggtcatga 32781121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University