View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_203 (Length: 212)
Name: NF8206A_low_203
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_203 |
 | |
|
| [»] scaffold0057 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 22 - 196
Target Start/End: Original strand, 46844530 - 46844704
Alignment:
| Q |
22 |
ccgtgtctgtcttattacatcaaaggaaagtatgatttgctaatttgtgtccgattagaattagaacgattccttgaaggaatgatagtgaataccatga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46844530 |
ccgtgtctgtcttattacatcaaaggaaagtataatttgctaatttgtgtccgattagaattagaccgattccttgaaggaatgatagtgaataccatga |
46844629 |
T |
|
| Q |
122 |
gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46844630 |
gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagag |
46844704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 48986 - 48944
Alignment:
| Q |
154 |
ggggtgagatggcattttgcagccatgaatgccgtgaccagag |
196 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
48986 |
ggggtgagatggcattttgcaaccctgaatgccgtaaccagag |
48944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University