View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_204 (Length: 211)
Name: NF8206A_low_204
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_204 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 22 - 191
Target Start/End: Complemental strand, 41168540 - 41168371
Alignment:
| Q |
22 |
caatggccaagtattaccaaaacaatatgctgaatgtactatatagaggcgacaaatacaattacgatcaatattcggtgtaatnnnnnnnnnnnnttcg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
41168540 |
caatggccaagtattaccaaaacaatatgctgaatgtactatatagaggcgacaaatacaattacgatcaatattcggtgtaataaaaaataaaaatttg |
41168441 |
T |
|
| Q |
122 |
taaggttttttagcattcaactctcaacgatagacaccaaacaatgtcttccctgagtccctttttaata |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41168440 |
taaggttttttagcattcaactctcaacgatagacaccaaacaatgtcttccctgagtccctttttaata |
41168371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University