View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_210 (Length: 207)
Name: NF8206A_low_210
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_210 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 22 - 189
Target Start/End: Complemental strand, 7899486 - 7899319
Alignment:
| Q |
22 |
atacagctcacgcgtggttgacttgatccgacacatggcttcagttggttaatgtgcaaggagtttttggcatacatctagtgcaatgacacttctatct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7899486 |
atacagctcacgcgtggttgacttgatccgacacatggcttcagttggttaatgtgcaaggagtttttggcatacatctagtgcaatgacacttctatct |
7899387 |
T |
|
| Q |
122 |
tacaaatcaagcattcagtaaagtagatttttggaataattttgcttctgttaaatgacgagaatatt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7899386 |
tacaaatcaagcattcagtaaagtagatttttggaataattttgcttctgttaaatgacgagaatatt |
7899319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University