View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_53 (Length: 319)
Name: NF8206A_low_53
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-172; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 36170688 - 36170376
Alignment:
| Q |
1 |
gatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattgttatttcctttgtttttgaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170688 |
gatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattgttatttcctttgtttttgaaga |
36170589 |
T |
|
| Q |
101 |
atatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccgtttgcctaaccaactcatctccaaaggcaatattctga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170588 |
atatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccatttgcctaaccaactcatctccaaaggcaatattctga |
36170489 |
T |
|
| Q |
201 |
atgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcctcaaccataaatctcttaactt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36170488 |
atgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcctcaaccatgaatctcttaactt |
36170389 |
T |
|
| Q |
301 |
cctcaacaccaac |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36170388 |
cctcaacaccaac |
36170376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 1286354 - 1286394
Alignment:
| Q |
1 |
gatccacaaaaccataactcattaaaatacttacagagcta |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286354 |
gatccacaaaaccataactcattaaaatacttacagagcta |
1286394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University