View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_88 (Length: 277)
Name: NF8206A_low_88
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_88 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 78 - 268
Target Start/End: Original strand, 48993569 - 48993759
Alignment:
| Q |
78 |
gaaggaccaaatgaatcaacacttggaatcaaaactacaattgggataattgtggcaagacttgtggtgcttcctgttataggaattggagttgttgtgt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48993569 |
gaaggaccaaatgaatcaacacttggaattaaaactacaattgggataattgtggcaagacttgtggtgcttcctgttataggaattggagttgttgtgt |
48993668 |
T |
|
| Q |
178 |
tggctgataagttgaattttttggttgaaaatgatgctatgtttaggtttgtgcttttgttgcaatatacaacaccaagtgctatattgtt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48993669 |
tggctgataagttgaattttttggttgaaaatgatgctatgtttaggtttgtgcttttgttgcaatatacaacaccaagtgctattttgtt |
48993759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 36166948 - 36166870
Alignment:
| Q |
5 |
cattatgggaggggattactcgctttaggttcttcctagggatgtcttggaccattgctcttaggcgttgaaggaagga |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
36166948 |
cattatgggaggggattactcgctttaggttcttcctagggatgtcttgggccattgctcttaggtgttgaaggaagga |
36166870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 78 - 265
Target Start/End: Complemental strand, 22624161 - 22623974
Alignment:
| Q |
78 |
gaaggaccaaatgaatcaacacttggaatcaaaactacaattgggataattgtggcaagacttgtggtgcttcctgttataggaattggagttgttgtgt |
177 |
Q |
| |
|
|||||||||||||| || | ||||||| | | |||||| ||||| || ||||||||||||| ||||||| |||||| | || ||||| |||||| | |
|
|
| T |
22624161 |
gaaggaccaaatgagtctagacttggacttagaactactattggtattgttgtggcaagactcttggtgctacctgttcttggtattgggattgttgctt |
22624062 |
T |
|
| Q |
178 |
tggctgataagttgaattttttggttgaaaatgatgctatgtttaggtttgtgcttttgttgcaatatacaacaccaagtgctatatt |
265 |
Q |
| |
|
|| | ||||| | ||||| ||||| |||||||||||||||||||| ||||||||||||||||| || ||| |||| ||||||||||| |
|
|
| T |
22624061 |
tgtcgaataagctaaatttcttggtcgaaaatgatgctatgtttagatttgtgcttttgttgcagtacacatcacctagtgctatatt |
22623974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University