View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8206A_low_94 (Length: 269)
Name: NF8206A_low_94
Description: NF8206A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8206A_low_94 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 20 - 254
Target Start/End: Complemental strand, 41404394 - 41404160
Alignment:
| Q |
20 |
cacatatttcatatggtttctgttcaatcgacttagaaggaagtcaaggaacacaattgcttgcgagtagagcacatgccaaaaatgactctaattgact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41404394 |
cacatatttcatatggtttctgttcaatcgacttagaaggaagtcaaggaacacaattgcttgcgagtagagcacatgccaaaaatgactctaattgact |
41404295 |
T |
|
| Q |
120 |
cgtaatctatcaaacatgtcttatagggtctgattcctactttcatacacatcatttcattgcagccacacgattgaaggtcttttgactgccaaaacca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
41404294 |
cgtaatctatcaaacatgtcttatagggtctgattcctactttcatacacatcatttcattgcagccacacgattgaaggtcttttgactgcgaatacca |
41404195 |
T |
|
| Q |
220 |
gaatctactatttatagcttcaacgtaaatgtgat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41404194 |
gaatctactatttatagcttcaacgtaaatgtgat |
41404160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University