View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8207_high_7 (Length: 240)
Name: NF8207_high_7
Description: NF8207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8207_high_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 32595305 - 32595533
Alignment:
| Q |
18 |
ctattgatattctaaaatgactttgtataatttgagacaatattgtgccttcctttctaatccatttacctactatagttgtgtacccttatacttcacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32595305 |
ctattgatattctaaaatgactttgtataatttgagacaatattgtgccttcctttctaatccatttacctactatagttgtgtacccttatacttcacg |
32595404 |
T |
 |
| Q |
118 |
taatgttaacctcaatgtatgttttgatgc-------tttcaaatgagagaattattaattgtggatgaaagcagtgtttataatgaacacaagagactc |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32595405 |
taatgttaacctcaacgtatgttttgatgctttcaattttcaaatgagagaattattaattatggaagaaagcagtgtttataatgaacacaagagactc |
32595504 |
T |
 |
| Q |
211 |
ttccaagttgaggattcatttgtcatttct |
240 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |
|
|
| T |
32595505 |
tt-caagttgaggattcatttgtcatttct |
32595533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University