View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_high_43 (Length: 247)
Name: NF8208A_high_43
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 410384 - 410160
Alignment:
| Q |
1 |
gagaggcatgtgaagtgagatgaaatcagcggttgtgattgcttgatcaaatgagactaattccacaccaacagcacgtgctctatcagctggagcataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410384 |
gagaggcatgtgaagtgagatgaaatcagcggttgtgattgcttgatcaaatgaaactaattccacaccaacagcacgtgctctatcagctggagcataa |
410285 |
T |
 |
| Q |
101 |
gggtcatgagcaatcacattcattcctaatccttttgcacgccttgcaacttcagatccaacttttccaaatcccattattgctaatgttttcccaacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
410284 |
gggtcatgagcaatcacattcattcctaatccttttgcacgccttgcaacttcagatccaacttttccaaaccccattattgctaatgttttcccaacca |
410185 |
T |
 |
| Q |
201 |
tagatactcccacatacttgcttct |
225 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
410184 |
tagatactccaacatacttgcttct |
410160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 85 - 225
Target Start/End: Complemental strand, 48785548 - 48785408
Alignment:
| Q |
85 |
atcagctggagcataagggtcatgagcaatcacattcattcctaatccttttgcacgccttgcaacttcagatccaacttttccaaatcccattattgct |
184 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| || ||||| || | || || |||||||| ||||| |||| |||||| || ||||||||||||| || |
|
|
| T |
48785548 |
atcagcaggagcataaggatcatgagcaataaccttcataccaagccccttagcacgcctagcaacctcagttccaaccttcccaaatcccattacagca |
48785449 |
T |
 |
| Q |
185 |
aatgttttcccaaccatagatactcccacatacttgcttct |
225 |
Q |
| |
|
| ||| |||||||| | || ||||| |||||||| ||||| |
|
|
| T |
48785448 |
agtgtcttcccaactagggaaactccaacatacttacttct |
48785408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University